View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19514_low_10 (Length: 360)
Name: NF19514_low_10
Description: NF19514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19514_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 310; Significance: 1e-174; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 18 - 355
Target Start/End: Original strand, 32863505 - 32863841
Alignment:
| Q |
18 |
cctagctctgggctggtgttgttgttgtactcaaaaccgtaaggcaaagttgtgtgtaggagtgtgagatggcaagtggtagcagaccgaatcctcttgc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32863505 |
cctagctctgggctggtgttgttgttgtactcaaaaccctaaggcaaagttctgtgtaggagtgtgagatggcaagtggtagcagaccgaatcctcttgc |
32863604 |
T |
|
| Q |
118 |
tgttgggcgtgtaataggggatgtattagacccctttgaaagtactattcctctcttaatcacctatggtaataggactgttaccaatggtggtgagctt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32863605 |
tgttgggcgtgtaataggggatgtattagacccctttgaaagtactattcctctcttagtcacctatggtaataggactgttaccaatggtggtgagctt |
32863704 |
T |
|
| Q |
218 |
aaaccttcccaagttgctaatcaaccccaagtgattattggcgtaaatgacccaacagccctctacaccctggtaattgcattaggtagttagcattgtt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32863705 |
aaaccttcccaagttgctaatcaaccccaagtgattattggcgtaaatgacccaacagccctctacaccctggtaattgcattaggtagtt-gcattgtt |
32863803 |
T |
|
| Q |
318 |
tatatacttagtatattatcaccatatcctttgcttct |
355 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
32863804 |
tatatacttagtatattatcaccatattctttgtttct |
32863841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 106 - 243
Target Start/End: Original strand, 32843604 - 32843741
Alignment:
| Q |
106 |
gaatcctcttgctgttgggcgtgtaataggggatgtattagacccctttgaaagtactattcctctcttaatcacctatggtaataggactgttaccaat |
205 |
Q |
| |
|
|||||| || ||||| ||||||||||||||||||||| ||||| | ||||||| | | |||||||| | | ||||||||||||||| ||| | ||| |
|
|
| T |
32843604 |
gaatccactagctgtagggcgtgtaataggggatgtaatagactcatttgaaaattccattcctcttcgagtgacctatggtaatagggatgtgaataat |
32843703 |
T |
|
| Q |
206 |
ggtggtgagcttaaaccttcccaagttgctaatcaacc |
243 |
Q |
| |
|
||| ||||||| |||||||| ||| ||| |||||||| |
|
|
| T |
32843704 |
ggttgtgagctcaaaccttctcaaattggaaatcaacc |
32843741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University