View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19514_low_18 (Length: 306)
Name: NF19514_low_18
Description: NF19514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19514_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 1 - 299
Target Start/End: Complemental strand, 32103767 - 32103469
Alignment:
| Q |
1 |
tttacttgtcatgaaacaacagaaaccaattttacctgtttcagacttttttcctacttttggaaaggtgttttagatatgattaaatattgcagagaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32103767 |
tttacttgtcatgaaacaacagaaaccaattttacctgtttcagacttttttcctacttttggaaaggtgttttagatatgattaaatattgcagagaaa |
32103668 |
T |
|
| Q |
101 |
tgaaagaaaaaactgtttggtaatgactgaatgaataaagaatggcggctccatctccattaggcagtaagcttcaaaacatgttgcaggctgcggtgca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32103667 |
tgaaagaaaaaactgtttggtaatgactgaatgaataaagaatggctgctccatctccattaggcagtaagcttcaaaacatgttgcaggctgcggtgca |
32103568 |
T |
|
| Q |
201 |
atctgttcagtggacttatagcctcttctggcaactttgcccacaacaactgtacgtcatcattttcttttcctcttcctcactcactatatattcttc |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32103567 |
atctgttcagtggacttatagcctcttctggcaactttgcccacaacaactgtacgtcatcattttcttttcctcttcctcactcactatatattcttc |
32103469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University