View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19514_low_19 (Length: 304)
Name: NF19514_low_19
Description: NF19514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19514_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 18 - 295
Target Start/End: Complemental strand, 4441154 - 4440875
Alignment:
| Q |
18 |
agaagtatccactgaagtcctaacctttgctacgacagaacctctgctctccacatatctacaactacagtttttctctgattcgatggtgttgactata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4441154 |
agaagtatccactgaagtcctaacctttgctacgacagaacctctgctctccacatatctacaactacagtttttctctgcttcgatggtgttgactata |
4441055 |
T |
 |
| Q |
118 |
caaagaaatcacggagtgatttttagcacgctctgatttcatctaaccaagattctatgattgattttcaggtagccctatgtc--atgcaccgtgtcag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4441054 |
caaagaaatcacggagtgatttttagcaagctctgatttcatctaaccaagattctatgattgattttcaggtagccctatgtcatatgcaccgtgtcag |
4440955 |
T |
 |
| Q |
216 |
catttgcttaactagattgggaaatacatcacatatgtttgcaaaattttctaagcgcacaccaattgaaatttgaacat |
295 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4440954 |
catttgcttaactagattggaaaatacatcacatatgtttacaaaattttctaagcgcacaccaattgaaatttgaacat |
4440875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University