View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19514_low_24 (Length: 264)
Name: NF19514_low_24
Description: NF19514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19514_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 25 - 167
Target Start/End: Complemental strand, 32104269 - 32104128
Alignment:
| Q |
25 |
gttgtactcataataatctctagttgtgttttattactgtttgtgctacacnnnnnnnnnatatattatctcgtacaatcaaaaaccaagctagctggcg |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32104269 |
gttgtactcataataatctctagttgtgttttattactgtttgtgctacactttttttt-atatattatctcgtacaatcaaaaaccaagctagctggcg |
32104171 |
T |
|
| Q |
125 |
ccctcaaaatgactaacacaactaactaacaaaccaaactatg |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32104170 |
ccctcaaaatgactaacacaactaactaacaaaccaaactatg |
32104128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 199 - 256
Target Start/End: Complemental strand, 32104098 - 32104041
Alignment:
| Q |
199 |
gtagcacccaaaaactggctggtagaccaaccagtcaaaaaatactccctcctttgct |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32104098 |
gtagcacccaaaaactggctggtagaccaaccagtcaaaaaatactccctcctttgct |
32104041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University