View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19514_low_25 (Length: 255)
Name: NF19514_low_25
Description: NF19514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19514_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 47728394 - 47728147
Alignment:
| Q |
1 |
ttaaattttttaatgtctgcaaccaaagtttaaatgctttacttgataattcaggcaccagaaatctcagatgcaaatccaaacctcttcaaaaacttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47728394 |
ttaaattttttaatgtctgcaaccaaagtttaaatgctttacttgataattcaggcaccagaaatctcagatgcaaatccaaacctcttcaaaaacttca |
47728295 |
T |
 |
| Q |
101 |
caagagtcttatgcaatgccaacacttctgaagggttccaacccaaaagggatgtgtctatccctgaagtgtacttaccagttggaaagttaggcccacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47728294 |
caagagtcttatgcaatgccaacacttctgaagggttccaacccaaaagggatgtgtctatccctgaagtgtacttaccagttggaaagttaggcccacc |
47728195 |
T |
 |
| Q |
201 |
aaatctgggccaaagcccattaaacagaaccatattagccttcatttc |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47728194 |
aaatctgggccaaagcccattaaacagaaccatattagccttcttttc |
47728147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 88 - 137
Target Start/End: Complemental strand, 47705586 - 47705537
Alignment:
| Q |
88 |
ttcaaaaacttcacaagagtcttatgcaatgccaacacttctgaagggtt |
137 |
Q |
| |
|
||||| ||||| | || ||| ||||||||||||||||||||||||||||| |
|
|
| T |
47705586 |
ttcaagaacttaataaaagtgttatgcaatgccaacacttctgaagggtt |
47705537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University