View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19516_low_23 (Length: 232)
Name: NF19516_low_23
Description: NF19516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19516_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 5 - 158
Target Start/End: Complemental strand, 7949266 - 7949114
Alignment:
| Q |
5 |
catttgaaaccgtctctccttatgttacttacactatattggttactaacaaatgtatgaatgaataaatagttgacacaaacttttagagacaggagtt |
104 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||||||| || | ||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7949266 |
catttgaagccgtctctccttgtgttacttacactatattggtggtta-ctaatgtatgaatgaataaatagttgatacaaacttttagagacaggagtt |
7949168 |
T |
 |
| Q |
105 |
ccatcttctttctctaactttaaatcttatttttcatctaaataaatggtttct |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7949167 |
ccatcttctttctctaactttaaatcttatttttcatctaaataaatggtttct |
7949114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University