View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19517_high_10 (Length: 329)
Name: NF19517_high_10
Description: NF19517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19517_high_10 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 6e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 82 - 329
Target Start/End: Complemental strand, 51238496 - 51238266
Alignment:
| Q |
82 |
atacagaattgacacctcgtttgtcaataaggtgtttgcctctgtctatatgataagagcttaattttgtaactttgataataataataaacaaaacatg |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| |||||||| | |||||||||||||| |||||||||| |
|
|
| T |
51238496 |
atacagaattgacacctcgtttgtcaataaggtgtttgcctccgtctctatgataata---------------tttgataataataa---acaaaacatg |
51238415 |
T |
 |
| Q |
182 |
ataaacacacgaagacattcacataaa-taattgnnnnnnntggaaggaccacttatagcaacattaaacaaactcatctgaaaactagttattataaat |
280 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51238414 |
ataaacacactaagacattcacataaaataattgaaaaaaatggaaggaccacttatagcaacattaaacaaactcatctgaaaactagttattataaat |
51238315 |
T |
 |
| Q |
281 |
ttcactccaaatcacatcttccatggtgtgcaagcaaggaggttgaaac |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
51238314 |
ttcactccaaatcacatcttccatggtgtgcaagcaaggaggctgaaac |
51238266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University