View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19519_high_40 (Length: 206)
Name: NF19519_high_40
Description: NF19519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19519_high_40 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 15 - 192
Target Start/End: Complemental strand, 26485119 - 26484942
Alignment:
| Q |
15 |
catagggaggaaacatacagtgaaacatgatgggtcgagaaagatttcaggtaaagatgcagatgccggtgcattaatgttccttcgaaccccaatttcc |
114 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26485119 |
catagagaggaaacatacagtgaaacatgatgggtcgagaaagatttcaggtaaagatgcagatgccggtgcattaatgttccttcgaaccccaatttcc |
26485020 |
T |
|
| Q |
115 |
ggaggaactatccccatattgtttatcaatccaccacaacatgaaacttgttgttgtgctgaattgaattgaagatat |
192 |
Q |
| |
|
||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26485019 |
ggagggagtatccccatattgtttatcaatccaccacaacatgaaacttgttgttgtgctgaattgaattgaagatat |
26484942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University