View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19519_low_24 (Length: 326)
Name: NF19519_low_24
Description: NF19519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19519_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 9 - 304
Target Start/End: Complemental strand, 36582468 - 36582173
Alignment:
| Q |
9 |
ataattctttataactagtatatgtagnnnnnnnnnnnnttcagattgtctacaattgttaatacccacatttatgcagtcggcacatcaagggttgttg |
108 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36582468 |
ataattctttataactagtatatgtagaaaaaacaaaaattcagattgtctacaattgttaatacccacatttatgcagtcagcacatcaagggttgttg |
36582369 |
T |
 |
| Q |
109 |
attctagatcaaatatttcaaatttcaatacagtcggaattttaaatttgaaccgtctaatgtgcagattgtgtgaatgcgggtgattgatgaccgcata |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36582368 |
attctagatcaaatatttcaaatttcaatacgatcggaattttaaatttgaaccgtctaatgtgcagattgtgtgaatgcgggtgattgatgaccgcata |
36582269 |
T |
 |
| Q |
209 |
caatccaaattcaaaagcactcactgacctgcatattattgagagttgtgaaatattttcatctacattttctcaatcttatttaccgttgtctcg |
304 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36582268 |
caatccaaattcaaaaacactcactgacctgcatattgttgagagttgtgaaatattttcatctaccttttctcaatcttatttaccgttgtctcg |
36582173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University