View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19519_low_25 (Length: 324)
Name: NF19519_low_25
Description: NF19519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19519_low_25 |
 | |
|
| [»] scaffold0649 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0649 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: scaffold0649
Description:
Target: scaffold0649; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 93 - 303
Target Start/End: Complemental strand, 6027 - 5816
Alignment:
| Q |
93 |
ataatgtacttttcatgcttcgannnnnnnaatacgtttgtagaccaacccggtaacgaatttccaaaagggagtgaataatgtaccttgaacaatttca |
192 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6027 |
ataatgtacttttcatgcttcggtttttttaatacgtttgtagaccaacccggtaacgaatttccaaaagggagggaataatgtaccttgaacaatttca |
5928 |
T |
|
| Q |
193 |
tcttcatagttataataaatataagaaaaacaaaagtttattcatttcagagattgccaaactgttaacagtagccaacagaatatcattc-acaataca |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
5927 |
tcttcatagttataataaatataagaaaaacaaaagtttattcatttcagagatcgccaaactgttaatagtagccaacagaatatcattcaacaataca |
5828 |
T |
|
| Q |
292 |
atcaaaccaatg |
303 |
Q |
| |
|
|||||||||||| |
|
|
| T |
5827 |
atcaaaccaatg |
5816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0649; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 37 - 94
Target Start/End: Complemental strand, 6131 - 6074
Alignment:
| Q |
37 |
aatatccaagaattggtgtagaaataaagtaattctcacttcatgaatcattatggat |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6131 |
aatatccaagaattggtgtagaaataaagtaattctcacttcatgaatcattatggat |
6074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 49; Significance: 5e-19; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 34 - 94
Target Start/End: Complemental strand, 20968406 - 20968346
Alignment:
| Q |
34 |
aagaatatccaagaattggtgtagaaataaagtaattctcacttcatgaatcattatggat |
94 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
20968406 |
aagaacatccaagaactggtgtagaaataaagtaattctcacttcatgaatcatcatggat |
20968346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 232 - 301
Target Start/End: Complemental strand, 20981018 - 20980948
Alignment:
| Q |
232 |
attcatttcagagattgccaaactgttaacagtagccaacagaatatcattc-acaatacaatcaaaccaa |
301 |
Q |
| |
|
|||||||||||| |||| | ||||||||||| ||||||| ||| ||||||| |||||| ||||||||||| |
|
|
| T |
20981018 |
attcatttcagacattgtcgaactgttaacaatagccaatagacaatcattcaacaatataatcaaaccaa |
20980948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University