View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19519_low_31 (Length: 279)
Name: NF19519_low_31
Description: NF19519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19519_low_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 4 - 263
Target Start/End: Complemental strand, 10573781 - 10573521
Alignment:
| Q |
4 |
tcaattccacccccaaattgaacc-taattcattctctcacaacaacaatgaacaacccaactgatctcagctcacccaatcgcaaaccagaagctgaac |
102 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10573781 |
tcaatttcacccccaaattgaaccctaattcattctctcacaacaacaatgaacaacccaactgatctcagctcacccaatcgcaaaccagaagctgaac |
10573682 |
T |
 |
| Q |
103 |
aacaacaacaaggatcatgcactccggaaaacaccttcaagaagagaaaatccccttcaaaatccactcctcggnnnnnnncctccagggtaatttaatc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10573681 |
aacaacaacaaggatcatgcactccggaaaacaccttcaagaagagaaaatccccttcaaaatccactcctcggaaaaaaacctccagggtaatttaatc |
10573582 |
T |
 |
| Q |
203 |
atcacaattgttattattactgtgtttttgttgttgttatgctgttaattttagctgtaat |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10573581 |
atcacaattgttattattactgtgtttttgttgttgttatgctgttaattttagctgtaat |
10573521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University