View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19519_low_34 (Length: 256)
Name: NF19519_low_34
Description: NF19519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19519_low_34 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 20 - 249
Target Start/End: Original strand, 50492088 - 50492317
Alignment:
| Q |
20 |
gaactgactcgagaaagttatcattgtagagatcttctccatcttcctcttcctctggatcgggttcgtcgcgaatgatatcgggatcaacggaagcttc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
50492088 |
gaactgactcgagaaagttatcattgtagagatcttctccatcttcctcttcctctggatcgggttcatcgcgaatgatatcgggatcaacggaagcttc |
50492187 |
T |
|
| Q |
120 |
gtcgtcttcagatgcgcggctggtgtgagtgtgaggaagttgatcagtgttgaaaccggcggatggtgaggttggtgaatcgggagttgatgcaggattt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
50492188 |
gtcgtcttcagatgcgcggctggtgtgagtgtgaggaagttgatcagtgttgaaaccggcggatggtgaagttggtgaatcgggagttgatgcaggattt |
50492287 |
T |
|
| Q |
220 |
tctggatccatgattcttcgcttcttctct |
249 |
Q |
| |
|
||||||||||||||||||| |||||||||| |
|
|
| T |
50492288 |
tctggatccatgattcttcacttcttctct |
50492317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University