View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19519_low_40 (Length: 233)
Name: NF19519_low_40
Description: NF19519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19519_low_40 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 18 - 211
Target Start/End: Original strand, 6186751 - 6186944
Alignment:
| Q |
18 |
atgatgttagcttattcaaccttgtttgcaaaggtgtttcctcgtcgatgtcattgcttatcgaactcatcatttgtccccatgttgtgttcataccgac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6186751 |
atgatgttagcttattcaaccttgtttgcaaaggtgtttcctcatcgatgtcattgcttatcgaactcatcatttgtccccatgttgtgttcataccgac |
6186850 |
T |
 |
| Q |
118 |
cgatgtaacaagcatttttgcatatccatcgacaacttttgtcccggaaagcaaaaaaggatgaaaattttgatttatctctacatgatcactc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6186851 |
cgatgtaacaagcatttttgcatatccatcgacaacttttgtcccggaaagcaaaaaaggatgaaaattttgatttatctctacatgatcactc |
6186944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 20 - 207
Target Start/End: Original strand, 4243697 - 4243884
Alignment:
| Q |
20 |
gatgttagcttattcaaccttgtttgcaaaggtgtttcctcgtcgatgtcattgcttatcgaactcatcatttgtccccatgttgtgttcataccgaccg |
119 |
Q |
| |
|
||||| || ||||||||||||||||||||||| ||||| |||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4243697 |
gatgtaagtttattcaaccttgtttgcaaaggggtttcttcgttgatgtcattgcttatggaactcatcatttgtccccatgttgtgttcataccaaccg |
4243796 |
T |
 |
| Q |
120 |
atgtaacaagcatttttgcatatccatcgacaacttttgtcccggaaagcaaaaaaggatgaaaattttgatttatctctacatgatc |
207 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
4243797 |
atgtaacgagcatttttgcatatccatcgacaacttttgttccggaaagcaaaaaaggatgaaagttttgattaatctctacatgatc |
4243884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 76 - 178
Target Start/End: Original strand, 38358424 - 38358526
Alignment:
| Q |
76 |
tatcgaactcatcatttgtccccatgttgtgttcataccgaccgatgtaacaagcatttttgcatatccatcgacaacttttgtcccggaaagcaaaaaa |
175 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||| | || || ||||| |||||||| | ||||||||||| |||||||||| ||||| | ||||||| |
|
|
| T |
38358424 |
tatcgagctcatcatttgtccccatgatgtgtttttgcccacagatgttacaagcatctgagcatatccatccacaacttttgcgccggacaacaaaaaa |
38358523 |
T |
 |
| Q |
176 |
gga |
178 |
Q |
| |
|
||| |
|
|
| T |
38358524 |
gga |
38358526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University