View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19519_low_41 (Length: 216)
Name: NF19519_low_41
Description: NF19519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19519_low_41 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 15 - 201
Target Start/End: Original strand, 332010 - 332195
Alignment:
| Q |
15 |
cataggatcaaagcaataattgttacaactatcgtaactcaacccattaaaatgccgttgaatacacttaatatctattaatttgctcaattactaannn |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
332010 |
cataggatcaaagcaataattgttacaactatcgtaactcaacccattaaaatgccgttgaatacacttaatatctattaatttgctcaactactaa-tt |
332108 |
T |
|
| Q |
115 |
nnnnnnnnnnnnnnngccaccgagagtttattggatggcatatatttgtgttgcagagcttttagaaaaagttaaagacgtgatgat |
201 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
332109 |
tttatttttatttttgccatcgagagtttattggatggcatatatttgtgttgcagagcttttagaaaaagttaaagacgtgatgat |
332195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University