View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1951_high_12 (Length: 239)
Name: NF1951_high_12
Description: NF1951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1951_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 15 - 222
Target Start/End: Original strand, 5932975 - 5933190
Alignment:
| Q |
15 |
gtacttccatcaataacaacctttttctccgggcgaatgggggtggtgtacctgcacacacatctagtgttaag--------tgccttggaatgataggc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5932975 |
gtacttccatcaataacaacctttttctctgggcgaatgggggtggtgtacctgcacacacatctagtgttaagtcagtaagtgccttggaatgataggc |
5933074 |
T |
 |
| Q |
107 |
gttttaggggtaaaagtgaggatacctgacctagtgtctatggattagtatttatagtgcaggtttagagttttaacccttaaacgtttacctgagaagc |
206 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
5933075 |
gttttaggggtaaaagtgaggatacctaacctagtgtctatggattagtatttatagtgcaggtttagagttttgacccttagacgtttacctgagaagc |
5933174 |
T |
 |
| Q |
207 |
tatctttgagaggtat |
222 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
5933175 |
tatctttgagaggtat |
5933190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 34 - 73
Target Start/End: Complemental strand, 25692378 - 25692339
Alignment:
| Q |
34 |
cctttttctccgggcgaatgggggtggtgtacctgcacac |
73 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25692378 |
cctttttctccgggcgaatgagggtggtgtacctgcacac |
25692339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 96 - 174
Target Start/End: Complemental strand, 25692308 - 25692231
Alignment:
| Q |
96 |
gaatgataggcgttttaggggtaaaagtgaggatacctgacctagtgtctatggattagtatttatagtgcaggtttag |
174 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||| ||| |||||| |||| ||||||||||||| | |||||||| |
|
|
| T |
25692308 |
gaatgataggtattttaggg-taaaagtgagcgtacctaacccagtgtccatgggttagtatttatagagtaggtttag |
25692231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University