View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1951_low_13 (Length: 250)
Name: NF1951_low_13
Description: NF1951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1951_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 78 - 236
Target Start/End: Original strand, 40682782 - 40682940
Alignment:
| Q |
78 |
gatagtataaacaagggagcatgcatcagttgaacatgacctcacagttaggtcgcatctgagaccatgccttaggtataatgattggtggtcaaaagga |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40682782 |
gatagtataaacaagggagcatgcatcagttgaacatgacctcacagttaggtcgcatctgagaccatgccttaggtataatgattggtggtcaaaagga |
40682881 |
T |
 |
| Q |
178 |
gcggagaagtacaacatagctgagtttgaatcatattttagatgaggtttgaggaaggt |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40682882 |
gcggagaagtacaacatagctgagtttgaatcatattttagatgaggtttgaggaaggt |
40682940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University