View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1951_low_6 (Length: 301)
Name: NF1951_low_6
Description: NF1951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1951_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 1e-56; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 85 - 213
Target Start/End: Complemental strand, 14985935 - 14985805
Alignment:
| Q |
85 |
atgcccgtttttagagt--aataataacttttcttgaaattgttgtcaaggattatttttctattagaatggcattctctttttgttgttgatttagatg |
182 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14985935 |
atgcccgtttttagagtgtaataataacttttcttgaaattgttgtcaaggattatttttctattagaatggcattctctttttgttgttgatttagata |
14985836 |
T |
|
| Q |
183 |
attttttacatgtaagaactgtgttgtcttt |
213 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |
|
|
| T |
14985835 |
attttttacatgtaagaactatgttgtcttt |
14985805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 14986512 - 14986432
Alignment:
| Q |
1 |
caaatcagggttccaaagaatctcatacaaaatgatctttttccaagattacccaaataagcaagatcacttctacatgga |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14986512 |
caaatcagggttccaaagaatctcatacaaaatgatctttttccaagattacccaaataagcaagatcacttctacatgga |
14986432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 207 - 286
Target Start/End: Complemental strand, 14985775 - 14985696
Alignment:
| Q |
207 |
tgtctttttaataagaactttcatagctagaacggcaaaagaaaattagttaacgatgaattcaatgaaatacaaatact |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14985775 |
tgtctttttaataagaactttcatagctagaacggcaaaagaaaattagttaacgatgaattcaatgaaatacaaatact |
14985696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University