View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19520_high_61 (Length: 289)
Name: NF19520_high_61
Description: NF19520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19520_high_61 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 118 - 279
Target Start/End: Complemental strand, 43666099 - 43665938
Alignment:
| Q |
118 |
ctttcacttttaactccctatgttcagttactcggtatcccccatacttgggccgcgtacatatggctctgcggcccaatctcggggatgcttgtccaac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43666099 |
ctttcacttttaactccctatgttcagttactcggtatcccccatacttgggccgcatacatctggctctgcggcccaatctcggggatgcttgtccaac |
43666000 |
T |
|
| Q |
218 |
ctattgtcggttatcacagcgatcgttgcacttcacgcttcggtcgccgtcgtcctttcatc |
279 |
Q |
| |
|
| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43665999 |
cgattgtcggttatcacagtgatcgttgcacttcacgcttcggtcgccgtcgtccgttcatc |
43665938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 9 - 122
Target Start/End: Complemental strand, 2136605 - 2136492
Alignment:
| Q |
9 |
gacatcatcataaatacacaataacacatctctataaatgttcaccatttcttctcactcaccccctcttctgtttaagaaacagccttgagagaaacag |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2136605 |
gacatcatcataaatacacaataacacatctctataaatgttcaccatttcttctcactcaccccctcttctgtttaagaaacagccttgagagaaacag |
2136506 |
T |
|
| Q |
109 |
aatcaaatcctttc |
122 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
2136505 |
aatcaaatcctttc |
2136492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University