View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19520_high_64 (Length: 271)
Name: NF19520_high_64
Description: NF19520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19520_high_64 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 12 - 255
Target Start/End: Complemental strand, 46875783 - 46875540
Alignment:
| Q |
12 |
agaatatagtgctttcctgaccgtaccagaatgtggaatgtcctttccgcatgtgctcatgttcaagctaaatgggaatcaatcaaacatatgcaaatga |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46875783 |
agaaaatagtgctttcctgaccgtaccagaatgtggaatgtcatttccgcatgtgctcatgttcaagctaaatgggaatcaatcaaacatatgcaaatga |
46875684 |
T |
|
| Q |
112 |
aaatggacttgggtggtatctatctgtcaacactcaatagtgccctgcttgattgatcagccatgtcaagtatggaacataatctcacagtaagagacgc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| || |
|
|
| T |
46875683 |
aaatggacttgggtggtatctatctgtcaacactcaatagtgccctacttgattgatcagccatgtcaagtatggaacgtaatctcacagtaagagatgc |
46875584 |
T |
|
| Q |
212 |
attacaaaatttgatatgtcggtcatgtatagtcaatgattttg |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
46875583 |
attacaaaatttgatatgtcggtcatgtatggtcaatgattttg |
46875540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University