View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19520_high_67 (Length: 262)
Name: NF19520_high_67
Description: NF19520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19520_high_67 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 3911264 - 3911018
Alignment:
| Q |
1 |
tatgtatatgcaagtgctatctatgacaatgtggttgagttgagacatggtagaagtaaataacacagtgaacagtaaggtgtggtgtgtcgttggattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3911264 |
tatgtatatgcaagtgctatctatgacaatgtggttgagttgagacatggtagaagtaaataacacagtgaacagtaaggtgtggtgtgtcgttggattt |
3911165 |
T |
|
| Q |
101 |
aacttttgattctcagatgtcactttctttgcagttttgctatgccattatctgtgtgagtttgtggggaaatgggtcatacactagtaaagacactcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3911164 |
aacttttgattctcagatgtcactttctttgcagttttgctatgccattatctgtgtgagtttgtggggaaatgggtcatacactagtaaagacactcat |
3911065 |
T |
|
| Q |
201 |
cttatacacactaactagttacactatttatgctattacatcgttat |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3911064 |
cttatacacactaactagttacactatttatgctattacatcgttat |
3911018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University