View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19520_high_71 (Length: 248)
Name: NF19520_high_71
Description: NF19520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19520_high_71 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 7 - 114
Target Start/End: Complemental strand, 11396321 - 11396214
Alignment:
| Q |
7 |
gagatgaaagtccctgagaaaatgactgctgagacggttgtgatcgatgttgcgacatcgcatgcaatccattcgatacattgttctgcctcctatcaca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11396321 |
gagatgaaagtccctgagaaaatgactgctgagacggttgtgatcgatgttgcgacatcgcatgcaatccattcgatacattgttctgcctcctatcaca |
11396222 |
T |
|
| Q |
107 |
ttttccac |
114 |
Q |
| |
|
|||||||| |
|
|
| T |
11396221 |
ttttccac |
11396214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 145 - 248
Target Start/End: Complemental strand, 11396183 - 11396080
Alignment:
| Q |
145 |
ttcataaatattcatccagttacagaaacctaaaaccgcatactcaaaaaagaagcacctgaatttgaactgaaacacatgattcaactttaaataagca |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| ||| |||||||| | |
|
|
| T |
11396183 |
ttcataaatattcatccagttacagaaacctaaaactgcatactcaaaaaagaagcacgtgaatttgaactgaaacacatgattcgactataaataagaa |
11396084 |
T |
|
| Q |
245 |
tgaa |
248 |
Q |
| |
|
|||| |
|
|
| T |
11396083 |
tgaa |
11396080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University