View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19520_low_26 (Length: 447)
Name: NF19520_low_26
Description: NF19520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19520_low_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 260; Significance: 1e-145; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 272
Target Start/End: Complemental strand, 40799662 - 40799391
Alignment:
| Q |
1 |
atgcgtgtatgcaattgtttaaagtaaatgtagtaaaggtaaattgaaggaaatttaaaaggaaattgccaacgaggcataactttttgcataggcttct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
40799662 |
atgcgtgtatgcaattgtttaaagtaaatgtagtaaaggtaaattgaaggaaatttaaaaggaaattgccaacgacgcataactttctgcataggcttct |
40799563 |
T |
|
| Q |
101 |
tgaagtgattgtttaggcttttatgcccctttctaatagaataaccttagtttgtggcaatacagtgatgaggaaaaggcctttcaaatttgctaaactt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40799562 |
tgaagtgattgtttaggcttttatgcccctttctaatagaataaccttagtttgtggcaatacagtgatgaggaaaaggcctttcaaatttcctaaactt |
40799463 |
T |
|
| Q |
201 |
atttcttcatgtttttgttggtgtgtggatcaccatccatacacaaaattaacaggtgagatttggcagacc |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40799462 |
atttcttcatgtttttgttggtgtgtggatcaccatccatacacaaaattaacaggtgagatttggcagacc |
40799391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 335 - 439
Target Start/End: Complemental strand, 40799328 - 40799224
Alignment:
| Q |
335 |
gcctatataattgcatttaccttaaacactttaattaatggtggaggaaaataggctacatcaaattgttccatcttcttcctcccttttccccttcttc |
434 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40799328 |
gcctatataattgcatttaccttaaacactttaattaatggtcgaggaaaataggctacatcaagttgttccatcttcttcctcccttttccccttcttc |
40799229 |
T |
|
| Q |
435 |
atctc |
439 |
Q |
| |
|
||||| |
|
|
| T |
40799228 |
atctc |
40799224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University