View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19520_low_31 (Length: 429)
Name: NF19520_low_31
Description: NF19520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19520_low_31 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 345; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 14 - 407
Target Start/End: Original strand, 43101855 - 43102251
Alignment:
| Q |
14 |
atatagaaagcaccaaggttcacattcgccgccacacctggcctagctgttcccctaacaacaccgcaacccaccgtctgaggacagttaccaagttcac |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43101855 |
atatagaaagcaccaaggttcacattcgccgccacacctggcctagctgttcccctaacaacaccgcaacccaccgtctgaggacagttaccaagttcac |
43101954 |
T |
|
| Q |
114 |
acaatccaaggattggaagtgccaaagaagtcagccgaagaatattttcatctgcagtaaacattcttccccaacgaaacctcatccctgtggcaaaaat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43101955 |
acaatccaaggattggaagtgccaaagaagtcagccgaagaatattttcatctgcagtaaacattctgccccaacgaaacctcatccctgtggcaaaaac |
43102054 |
T |
|
| Q |
214 |
cgtcgctgagaaacctataattacagc-aacgaaaattgcca-ccaggg-atgataacttagcttggaaaggacggttagcacctagctcgtttccaaca |
310 |
Q |
| |
|
||| |||||||||||||||||||||| ||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43102055 |
cgtgtctgagaaacctataattacagctcacgaaaattgccagccagggcatgataacttagcttggaaaggacggttagcacctagctcgtttccaaca |
43102154 |
T |
|
| Q |
311 |
cgggtggaaacggcgaatccaagtgaagatggaaagacataaatgaatgaagtagtttgaattagaatcccgatagaagcaatggttacggtggggt |
407 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43102155 |
cgggtggaaactgcgaatccaagtgaagatggaaagacataaatgaatgaagtagtttgaattagaatcccgatagaagcaatggtaacggtggggt |
43102251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University