View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19520_low_36 (Length: 410)
Name: NF19520_low_36
Description: NF19520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19520_low_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 365; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 365; E-Value: 0
Query Start/End: Original strand, 1 - 394
Target Start/End: Original strand, 11711981 - 11712374
Alignment:
| Q |
1 |
tggtgatggtgaaggcaaatcatccggactgcgagcttatgtgacgcagttggatacggaggcacttcagagacttgctaccgtacgctccaaggaagct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11711981 |
tggtgatggtgaaggcaaatcatccggactgcgagcttatgtgacgcagttggatacggaggcacttcagagacttgctaccgtacgctccaaggaagct |
11712080 |
T |
|
| Q |
101 |
atatcactgattgaaaagcaaactcaggccctctttggaaggcctgatatccgcctctctggcgatggttcgattgaaactaccaatgatgaagttcttt |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11712081 |
atatcattgattgaaaagcaaactcaggccctctttggaaggcctgatatccgcctctctggcgatggttcgattgaaactaccaatgatgaagttcttt |
11712180 |
T |
|
| Q |
201 |
cacttaccttctcaggcttgactatgcttgttttggaatctgttgcttttggatcattcttatgggacgaagaaaactatgttgagtccaagtatccttt |
300 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11712181 |
cgcttaccttctcaggcttgactatgcttgttttggaatctgttgcttttggatcattcttatgggacgaagaaaactatgttgagtccaagtatccttt |
11712280 |
T |
|
| Q |
301 |
tcttgctaaatagaagactgtacttgttgannnnnnnctattcattttagtttgtaaatgtaatgcatggaactttactccaatgaattgattg |
394 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11712281 |
tcttgctaaatagaagactgtacttgttgatttttttctattcattttagtttgtaaatgtaatgcatggaactttactccaatgaattgattg |
11712374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University