View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19520_low_40 (Length: 404)
Name: NF19520_low_40
Description: NF19520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19520_low_40 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 154 - 399
Target Start/End: Original strand, 33923235 - 33923480
Alignment:
| Q |
154 |
tcgaacgaatttgaaacttagggagcaaaagcaaagagaagaacccagatggaagattatcaacaaaggagatcaacatcttgagcatactaccaccttc |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33923235 |
tcgaacgaatttgaaacttagggagcaaaagcaaagagaagaacccagatggaagattatcaacaaaggagatcaacatcttgagcatacttccaccttc |
33923334 |
T |
|
| Q |
254 |
attctccaaaccattatgcatttcaacaaccatagcttcagcaacactcttcaacttctcaattgatgtctcacactcttcaccaaacaccttcaatatc |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33923335 |
attctccaaaccattatgcatttcaacaaccatagcttcagcaacactcttcaacttctcaattgatgtctcacactcttcaccaaacaccttcaatatc |
33923434 |
T |
|
| Q |
354 |
tcctcaaccttttcccacttttcacaccccactttacttctctgct |
399 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
33923435 |
tcctcaaccttttcccacttttcacacccccctttacttctttgct |
33923480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University