View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19520_low_63 (Length: 272)
Name: NF19520_low_63
Description: NF19520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19520_low_63 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 9e-76; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 16 - 163
Target Start/End: Complemental strand, 48876811 - 48876664
Alignment:
| Q |
16 |
atgaatgcttgtgatacactcattgccaagtagtttatagttcttacatttttgttcaataattatcaaagtattttcgaagtaccaactttatgttctt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48876811 |
atgaatgcttgtgatacactcattgccaagtagtttatagttcttacatttttgttcaataattatcaaagtattttcgaagtaccaactttatgttctt |
48876712 |
T |
 |
| Q |
116 |
attattcgagctaagatctctagtgactagccctatagaaaaaggggt |
163 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
48876711 |
attattcgagctaagatcactagtgactagccctatagaaaaaggggt |
48876664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 162 - 253
Target Start/End: Complemental strand, 48876609 - 48876518
Alignment:
| Q |
162 |
gtaacagaaatcaaaatgactgcacatttcaacaacatcatagtacctatgcttctcattcccctcgttttatctacattccagatgacacc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48876609 |
gtaacagaaatcaaaatgactgcacatttcaacaacatcatagtacctatgcttctcattcccctcgttttatctacattccagatgacacc |
48876518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University