View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19520_low_69 (Length: 257)
Name: NF19520_low_69
Description: NF19520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19520_low_69 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 18 - 257
Target Start/End: Complemental strand, 42086931 - 42086692
Alignment:
| Q |
18 |
aataggtacaccatgactcaatgattccaacactgagttccaaccacaatgactcaaaaacgcagaaactgatccatgtgataatatctcaacttgtggt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42086931 |
aataggtacaccatgactcaatgattccaacaccgagttccaaccacaatgactcaaaaacgcagaaactgatccatgtgacaatatctcaacttgtggt |
42086832 |
T |
 |
| Q |
118 |
gcccaatcatttactattatacctctctttgtttccacaatcttctccataaaccctaatggtaaccactcttcatatttaaactctgagtttatatcaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42086831 |
gcccaatcatttactattatacctctctttgtttccacaatcttctccataaaccctaatggtaaccactcttcatatttaaactctgagtttatatcaa |
42086732 |
T |
 |
| Q |
218 |
aacctattggtggcctcactacccagatgaaattctttcc |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42086731 |
aacctattggtggcctcactacccagatgaaattctttcc |
42086692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 40 - 77
Target Start/End: Original strand, 24462261 - 24462298
Alignment:
| Q |
40 |
gattccaacactgagttccaaccacaatgactcaaaaa |
77 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
24462261 |
gattccaacactgagttccatccacaatgagtcaaaaa |
24462298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University