View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19520_low_71 (Length: 250)
Name: NF19520_low_71
Description: NF19520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19520_low_71 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 1144495 - 1144257
Alignment:
| Q |
1 |
tcacaaattttcaagttcttgattgcttgaagattttcacaaatttccaagtcatgtatttagagaacaatgcattctttggtgtattgattggttctat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1144495 |
tcacaaattttcaagttcttgattgcttgaagattttcacaaatttccaagtcttgtatttagagaacaatgcattatttggtgtattgattggttctat |
1144396 |
T |
 |
| Q |
101 |
ttataggtctttctatgagccaaacttgtgatatgaaattgaatgtaggattcctagtagggtaaataaaacaatttcctttttggtgtaacacacgaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1144395 |
ttataggtctttctatgagccaaacttgtgatatgaaattgaatgtaggattcctagtagggtaaataaaacaatttcctttttggtgtaacacacgaca |
1144296 |
T |
 |
| Q |
201 |
cgaccatcaatcggaatcaataattctttttcgattcat |
239 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1144295 |
cgaccatcaatcagaatcaataattctttttcgattcat |
1144257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 5 - 66
Target Start/End: Original strand, 18281392 - 18281453
Alignment:
| Q |
5 |
aaattttcaagttcttgattgcttgaagattttcacaaatttccaagtcatgtatttagaga |
66 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
18281392 |
aaattttcaagtacttgattgcttgaatattttcacaaatttccaagtcttgtatttagaga |
18281453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University