View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19520_low_72 (Length: 248)

Name: NF19520_low_72
Description: NF19520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19520_low_72
NF19520_low_72
[»] chr8 (2 HSPs)
chr8 (7-114)||(11396214-11396321)
chr8 (145-248)||(11396080-11396183)


Alignment Details
Target: chr8 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 7 - 114
Target Start/End: Complemental strand, 11396321 - 11396214
Alignment:
7 gagatgaaagtccctgagaaaatgactgctgagacggttgtgatcgatgttgcgacatcgcatgcaatccattcgatacattgttctgcctcctatcaca 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11396321 gagatgaaagtccctgagaaaatgactgctgagacggttgtgatcgatgttgcgacatcgcatgcaatccattcgatacattgttctgcctcctatcaca 11396222  T
107 ttttccac 114  Q
    ||||||||    
11396221 ttttccac 11396214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 145 - 248
Target Start/End: Complemental strand, 11396183 - 11396080
Alignment:
145 ttcataaatattcatccagttacagaaacctaaaaccgcatactcaaaaaagaagcacctgaatttgaactgaaacacatgattcaactttaaataagca 244  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| ||| |||||||| |    
11396183 ttcataaatattcatccagttacagaaacctaaaactgcatactcaaaaaagaagcacgtgaatttgaactgaaacacatgattcgactataaataagaa 11396084  T
245 tgaa 248  Q
    ||||    
11396083 tgaa 11396080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University