View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19520_low_73 (Length: 245)
Name: NF19520_low_73
Description: NF19520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19520_low_73 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 24437577 - 24437349
Alignment:
| Q |
1 |
tgttgtagcaatttcagccattaaatgggagaatggcttgtgagtgacagggtctatacccatgcctgacagtttctttttcagcttggtgttccaatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24437577 |
tgttgtagcaatttcagccattaaatgggagaatggcttgtgagtgacagggtctatacccatgcctgacagtttctttttcagcttggtgttccaatga |
24437478 |
T |
 |
| Q |
101 |
tttttgacatcattgtcggtgcgtcctggcagctgcgctgctatcagagaccatctgaacaaccatttaagcaaatcattaacaatgtgataaagagaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
24437477 |
tttttgacatcattgtcggtgcgtcctggcagctgcgctgctatcagagaccatctgaacaaccatttaagcaaatcattaacaatgtgaaaaagagaat |
24437378 |
T |
 |
| Q |
201 |
ctcatacactatgaataacataacataac |
229 |
Q |
| |
|
||||||||||| ||||||||||||||||| |
|
|
| T |
24437377 |
ctcatacactacgaataacataacataac |
24437349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 29 - 117
Target Start/End: Original strand, 14778692 - 14778780
Alignment:
| Q |
29 |
gagaatggcttgtgagtgacagggtctatacccatgcctgacagtttctttttcagcttggtgttccaatgatttttgacatcattgtc |
117 |
Q |
| |
|
||||| ||||||||||| ||||||||||| ||||| ||||| |||||||||||||| |||||||||| || || ||||||||||| |
|
|
| T |
14778692 |
gagaaaggcttgtgagtaacagggtctatccccatttgagacagcttctttttcagctttgtgttccaattgttcttaacatcattgtc |
14778780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University