View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19520_low_75 (Length: 241)
Name: NF19520_low_75
Description: NF19520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19520_low_75 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 21 - 229
Target Start/End: Original strand, 43296821 - 43297029
Alignment:
| Q |
21 |
cacggatcatgtaagtaggatctgcaatacaatannnnnnnnagttcacagcactttcttcttttaatgagtaaacatatacagttctaaatagagaact |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43296821 |
cacggatcatgtaagtaggatctgcaatacaatattttttttagttcacagcattttcttcttttaatgagtaaacatatacagttctaaatagagaact |
43296920 |
T |
|
| Q |
121 |
caccgatgtacttcagatttataannnnnnnacttctttcaaagtgatcctacaatagaaacaaacgtttaaatgtaacaaaactaaaagaaaatcctac |
220 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43296921 |
caccgatgtacttcagatttataatttttttacttctttcaaagtgatcctacaatagaaacaaacgtttaaaagtaacaaaactaaaagaaaatcctac |
43297020 |
T |
|
| Q |
221 |
agcttgaaa |
229 |
Q |
| |
|
||||||||| |
|
|
| T |
43297021 |
agcttgaaa |
43297029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University