View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19520_low_78 (Length: 237)
Name: NF19520_low_78
Description: NF19520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19520_low_78 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 54904334 - 54904554
Alignment:
| Q |
1 |
ctagtgcagaagaactcattccttccaagttcaaactggatggtgcgttcagccgacaaaacatgtcattggatgcatatgctggcagtgtgctgcttag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
54904334 |
ctagtgcagaagaactcattccttccaagttcaaactggacggtgcgttcagccgacaaaacatgtcattggatgcatatgctggcagtatgctgcttag |
54904433 |
T |
|
| Q |
101 |
gactcttgttgatccagataaggtgcaaaaatccccatatccacctactgaacccttttgctggtagggatccaacgcatcatctcctctatcctgttta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54904434 |
gactcttgttgatccagataaggtgcaaaaatccccatatccacctactgaacccttttgctggtagggatccaacgcatcatctcctctatcctgttta |
54904533 |
T |
|
| Q |
201 |
gatagccatttgatatcaatt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
54904534 |
gatagccatttgatatcaatt |
54904554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 4 - 164
Target Start/End: Original strand, 54893839 - 54893999
Alignment:
| Q |
4 |
gtgcagaagaactcattccttccaagttcaaactggatggtgcgttcagccgacaaaacatgtcattggatgcatatgctggcagtgtgctgcttaggac |
103 |
Q |
| |
|
||||||||| |||||||| | ||||||||||| ||||||||||||||||||||||||||| || | |||||||||| |||||||||||| |||| || |
|
|
| T |
54893839 |
gtgcagaaggactcattcgtctaaagttcaaactagatggtgcgttcagccgacaaaacatgccactagatgcatatgttggcagtgtgctacttaagat |
54893938 |
T |
|
| Q |
104 |
tcttgttgatccagataaggtgcaaaaatccccatatccacctactgaacccttttgctgg |
164 |
Q |
| |
|
|||| ||||||||| ||||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
54893939 |
tcttcttgatccaggtaaggtgcaaaaatctccatatccacgtactgaacccttttgctgg |
54893999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 54888212 - 54888414
Alignment:
| Q |
1 |
ctagtgcagaagaactcattccttccaagttcaaactggatggtgcgttcagccgacaaaacatgtcattggatgcatatgctggcagtgtgctgcttag |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| | ||||||||||||| |||||||||||||| | | |||||||||| ||||| ||||||||||| |
|
|
| T |
54888212 |
ctagtgcagaagaactcattcctctcaagttcaagccagatggtgcgttcaaccgacaaaacatgttactagatgcatatgttggcaatgtgctgcttaa |
54888311 |
T |
|
| Q |
101 |
gactcttgttgatccagataaggtgcaaaaatccccatatccacctactgaacccttttgctggtagggatccaacgcatcatctcctctatcctgttta |
200 |
Q |
| |
|
|| |||| ||||||||| |||||| |||||||| ||||||||| |||||||| |||||| ||| ||||| || ||| ||||| ||||| |||||||| |
|
|
| T |
54888312 |
gattcttcttgatccaggtaaggtacaaaaatctccatatccagctactgaattcttttgtaggtgaggatctaatgcagcatctactctagcctgttta |
54888411 |
T |
|
| Q |
201 |
gat |
203 |
Q |
| |
|
||| |
|
|
| T |
54888412 |
gat |
54888414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University