View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19520_low_81 (Length: 206)
Name: NF19520_low_81
Description: NF19520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19520_low_81 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 20 - 190
Target Start/End: Complemental strand, 33377674 - 33377504
Alignment:
| Q |
20 |
attagcactcttgttactccaaatttggccaactatgctactactgtttttgattgaccaaattgaggggaatctcaatcttaatcttaatgaacaatca |
119 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33377674 |
attagcacttttgttactccaaatttggccaactatgctactactgtttttgattgaccaaattgaggggaatctcaatcttaatcttaatgaacaatca |
33377575 |
T |
|
| Q |
120 |
ccaacatgagttccatccaaggatgtagatttgctaccattgaaatggcaaagaactacacacaacatatt |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33377574 |
ccaacatgagttccatccaaggatgtagatttgctaccattgaaatggcaaagaactacacacaacatatt |
33377504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 20 - 108
Target Start/End: Complemental strand, 33383806 - 33383718
Alignment:
| Q |
20 |
attagcactcttgttactccaaatttggccaactatgctactactgtttttgattgaccaaattgaggggaatctcaatcttaatctta |
108 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| || | ||||| |||||||||| ||| |||||| ||||||| ||||||| |
|
|
| T |
33383806 |
attagcactcttgttgctccaaatttgtccaactatgctattagtattttttattgaccaaactgaagggaatttcaatctcaatctta |
33383718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University