View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19520_low_82 (Length: 204)
Name: NF19520_low_82
Description: NF19520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19520_low_82 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 19 - 190
Target Start/End: Original strand, 53273950 - 53274119
Alignment:
| Q |
19 |
atgttagaattaaatactactatgaaaaaacagacaaaatagttcgtgcagtcagaagttagatgaaggcatttcttgcaagcaataaatgagtgaaaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53273950 |
atgttagaattaaatactactatgaaaaaacagacaaaatagttcgtgcagtcagaagttagatgaaggcatttcttgcaagcaataaatgagtgaaaaa |
53274049 |
T |
 |
| Q |
119 |
attaagctgaaaagaaaagggagggaagaaagagtgagcatttgc---aagtagctaaacttattcttcaatgtg |
190 |
Q |
| |
|
||| |||| |||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
53274050 |
attcagct-----gaaaagggagggaagaaagagtgagcatttgcaagaagtagctagacttattcttcaatgtg |
53274119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University