View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19521_low_5 (Length: 234)
Name: NF19521_low_5
Description: NF19521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19521_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 11 - 217
Target Start/End: Complemental strand, 39049655 - 39049449
Alignment:
| Q |
11 |
aagaaaatactgcagaaaaattgtatccaattagcacttagtcttgttgagatacatagaactaaatcacaggagaggcttccaaagttccaactctact |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39049655 |
aagaaaatactgcagaaaaattgtatccaattagcacttagtcttgttgagatacatagaactaaatcacaggagaggcttccaaagttccaactctact |
39049556 |
T |
 |
| Q |
111 |
ggccgatgtctcggcatcaaagctatccaagtgggtgtatattttatatggatgaatgactgaagttactcttctagattaaaacagaacgtctaaagat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39049555 |
ggccgatgtctcggcatcaaagctatccaagtgggtgtatattttatatggatgaatgactgaagttactcttctagattaaaacagaacgtctaaagat |
39049456 |
T |
 |
| Q |
211 |
ataatct |
217 |
Q |
| |
|
||||||| |
|
|
| T |
39049455 |
ataatct |
39049449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University