View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19522_high_15 (Length: 378)
Name: NF19522_high_15
Description: NF19522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19522_high_15 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 254; Significance: 1e-141; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 113 - 378
Target Start/End: Original strand, 28675212 - 28675477
Alignment:
| Q |
113 |
cgctgaatcttcaggttctttgaaaaatctcaactttgaaactgaaacagactcactctgtttctcctcagagggttgctctgtttcttcattccttaaa |
212 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28675212 |
cgctgaatcttcaagttctttgaaaaatctcaactttgaaactgaaacagactcactctgtttctcctcagagggttgctctgtttcttcattccttaaa |
28675311 |
T |
|
| Q |
213 |
ggagaaccccaaaacctacttgctagtgaagatgaactatatggtgctgatttgcatctagttagtaacaaagcattttttggtggagtagaacaaaaag |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28675312 |
ggagaaccccaaaacctacttgctagtgaagatgaactatatggtgctgatttgcatctagttagtaacaaagcattttttggtggagtagaacaaaaag |
28675411 |
T |
|
| Q |
313 |
tggaagaatcgttagaatcagaaactaaaactttagctttaaatactctgttattttcctcttctt |
378 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28675412 |
tggaagaatcattagaatcagaaactaaaactttagctttaaatactctgttattttcttcttctt |
28675477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 18 - 48
Target Start/End: Original strand, 28675117 - 28675147
Alignment:
| Q |
18 |
gttagcactagaggaaatgctatagattctc |
48 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
28675117 |
gttagcactagaggaaatgctatagattctc |
28675147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University