View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19522_high_37 (Length: 208)
Name: NF19522_high_37
Description: NF19522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19522_high_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 20 - 198
Target Start/End: Original strand, 32460850 - 32461028
Alignment:
| Q |
20 |
aatcgaaaggagtgatgcttactcatcgcaacttgacggcgacggtggcggcatacaatgccgttaggattccgacggcgagtcctgcggtgtgtttgtt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32460850 |
aatcgaaaggagtgatgcttactcatcgcaacttgacggcgacggtggcggcatacaatgccgttaggattccgacggcgaatcctgcggtgtgtttgtt |
32460949 |
T |
 |
| Q |
120 |
aacagtgccgtgttttcacgtgtacggttttacgtaccttttgaagggtgtggctatgatggaaacggtggtgatgatg |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32460950 |
aacagtgccgtgttttcacgtgtacggttttacgtaccttttgaagggtgtggctatgatggaaacggtggtgatgatg |
32461028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University