View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19522_low_16 (Length: 364)
Name: NF19522_low_16
Description: NF19522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19522_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 2e-59; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 198 - 330
Target Start/End: Complemental strand, 34981990 - 34981858
Alignment:
| Q |
198 |
atttcagataacttctgttatcattctagacatatatacaacatatatcacatctcatgatgtctatacatgatccatatcattaaccgattccctaatt |
297 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34981990 |
atttcagataacttctgttatcattctacacatatatacaacatatatcacatctcatgatgtctatacatgatccatatcattaaccgatcccctaatt |
34981891 |
T |
|
| Q |
298 |
tcttcagcatttgaactttcatgtagtttgtaa |
330 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||| |
|
|
| T |
34981890 |
tcttcagcatttaaactttcttgtagtttgtaa |
34981858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 110 - 203
Target Start/End: Complemental strand, 34982624 - 34982531
Alignment:
| Q |
110 |
aagcttaagtgcctcacctgaaagttgaatctagaccgcaaaacaccactatctaaccaagcatcaccccaaaatgatgttgattaaaatttca |
203 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
34982624 |
aagcttaagtgcctcacctgaaaattgaatctagaccgcaaaacaccactatctaaccaaacatcacaccaaaatgatgttgattaaaatttca |
34982531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 13 - 99
Target Start/End: Complemental strand, 34982811 - 34982723
Alignment:
| Q |
13 |
taggcatgagaatacgataagcccttttacaaagtatccctcattggggt--tatgttgccagattcatttgtctattctattaacctg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34982811 |
taggcatgagaatacgataagcccttttacaaagtatccttcattggggttatatgttgccagattcatttgtctattctattaacctg |
34982723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University