View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19522_low_25 (Length: 265)
Name: NF19522_low_25
Description: NF19522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19522_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 258
Target Start/End: Complemental strand, 40011923 - 40011666
Alignment:
| Q |
1 |
gcatactaactaactcccaaaagaattgacagcaaatgaaaaacagaacgcaaacctatcaacaagaaacctcacaacctgaacctcacttcgcttactc |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40011923 |
gcattctaactaactcccaaaagaattgacagcaaatgaaaaacagaacacaaacctatcaacaagaaacctcacaacctgaacctcacttcgcttactc |
40011824 |
T |
 |
| Q |
101 |
gtctttttccttttcccattgttattttcatcgaaccaaacctcgttaatttcaatatcatcctcaaaaacccatttcaattcatccatttttctctcac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40011823 |
gtctttttccttttcccattgttattttcatcgaaccaaacctcgttaatttcaatatcatcctcaaaaacccatttcaattcatccatttttctctcac |
40011724 |
T |
 |
| Q |
201 |
gaaacatttccttcaactcaatcaaactctccctcttaagtttgtctcctctgtgctc |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40011723 |
gaaacatttccttcaactcaatcaaactctccctcttaagtttctctcctctgtgctc |
40011666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University