View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19522_low_35 (Length: 230)
Name: NF19522_low_35
Description: NF19522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19522_low_35 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 110 - 220
Target Start/End: Complemental strand, 10918529 - 10918420
Alignment:
| Q |
110 |
tcttctgggttggcagttgagaagaagaaggataagcagatgatgctagttcaatttaggttgatgatagtggtcatggtcatgaaaaagatgaatttga |
209 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10918529 |
tcttctaggttggcagttgagaagaagaaggataagcggatgatgctagttcaatttaggttgatgatagtggtcatggtcatgaacaagatgaatttg- |
10918431 |
T |
|
| Q |
210 |
ggatgatgatg |
220 |
Q |
| |
|
||||||||||| |
|
|
| T |
10918430 |
ggatgatgatg |
10918420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 127 - 220
Target Start/End: Complemental strand, 43958556 - 43958464
Alignment:
| Q |
127 |
tgagaagaagaaggataagcagatgatgctagttcaatttaggttgatgatagtggtcatggtcatgaaaaagatgaatttgaggatgatgatg |
220 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43958556 |
tgagaagaagaaggataagcggatgatgctagttcaatttaggttgatgatagtggtcatggtcatgaaaaagatgaatttg-ggatgatgatg |
43958464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University