View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19523_low_10 (Length: 261)
Name: NF19523_low_10
Description: NF19523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19523_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 10 - 127
Target Start/End: Original strand, 11160904 - 11161020
Alignment:
| Q |
10 |
ataattcttgattgtgattttctttgcgcatcaaacatttaccctttccatttattaacaactccaatgtgttaagtatgaagttgagtattttgtgagc |
109 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
11160904 |
ataattcttgattgtgattttctttgagcatcaaacatttacattttccatttattaacaactcc-atgtgttaagtatgaagttgagtattttgtgagc |
11161002 |
T |
 |
| Q |
110 |
tattatactaagaattgc |
127 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
11161003 |
tattatactaagaattgc |
11161020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University