View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19524_low_12 (Length: 235)
Name: NF19524_low_12
Description: NF19524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19524_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 38501943 - 38501722
Alignment:
| Q |
1 |
atatttgattttagttcctatgatgttagagagataaagaactaaaataaatattacaagatataacaaggaccgattttatatgaacaaatattgcaga |
100 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||| | ||||||||||||||||| |||||||||||| |||||||||||||| |||||||| ||| |
|
|
| T |
38501943 |
atatttgattttagttcctcagatgttacagagataaaggattaaaataaatattacaaaatataacaaggatcgattttatatgaaaaaatattgtaga |
38501844 |
T |
 |
| Q |
101 |
cactaaaataaaacgatagggaccaaaagtaaaataggatattttgtattggaaaattaagaaattattattgattaaattggcattaatgatcattttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
38501843 |
cactaaaataaaacgatagggaccaaaagtaaaataggatattttgtattggaaaattaagaaattattattgattaaattgacactaatgatcattttt |
38501744 |
T |
 |
| Q |
201 |
taaccgttttttgagggatttga |
223 |
Q |
| |
|
||||||| ||||||||||||||| |
|
|
| T |
38501743 |
taaccgt-ttttgagggatttga |
38501722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University