View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19525_low_11 (Length: 221)
Name: NF19525_low_11
Description: NF19525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19525_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 41929817 - 41929612
Alignment:
| Q |
1 |
ttctttcacaacatttggactatcatgaacttctgttatatttagtctgtgattattgatgtattaaatcagcaaaaaattcgtttt-gaatatggactt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
41929817 |
ttctttcacaacatttggactatcatgaacttctgttacatttagtctgtgattattgatgtattaaatcagcaaaaaattcctttttgaatatggactt |
41929718 |
T |
 |
| Q |
100 |
gatttcggcctttgtaggtcttactgaaacatgtgctggatcctttgtaacaataccaaacgaaataaatatgcttggtatggtgggacctcctttacca |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41929717 |
gatttcggcctttgtaggtcttactgaaacatgtgctggatcctttgtaacaataccaaacgaaataaatatgcttggtatggtgggacctcctttacca |
41929618 |
T |
 |
| Q |
200 |
tatatt |
205 |
Q |
| |
|
|||||| |
|
|
| T |
41929617 |
tatatt |
41929612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University