View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19527_low_3 (Length: 381)
Name: NF19527_low_3
Description: NF19527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19527_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 1 - 371
Target Start/End: Complemental strand, 19924172 - 19923784
Alignment:
| Q |
1 |
cccactccatccataactatcatatacgggcctcccataaaactgtggggggccaccttgtccaggaccataaacatgcccataaggaacaactggcgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19924172 |
cccactccatccataactatcatacacgggcctcccataaaactgtggggggccaccttgtccaggaccataaacatgcccgtaaggaacaactggcgaa |
19924073 |
T |
|
| Q |
101 |
ggatatgcaagaatggacattggcgctgtctgaggaaacattacagctggtgcagccgcggaaggaagtggagccggtgcctgagccggag--------- |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19924072 |
ggatatgcaagaatggacattggcgctgtctgaggaaacattacagctggtgcagccgcggaaggaagtggagccggtgcctgagccggagctggtgccg |
19923973 |
T |
|
| Q |
192 |
---ctggagctggacttggattttgtttaggcgggccaggttgtgcaatcggctttgcctcggccacgggcnnnnnnncttgctctttggg------tgg |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| || |||||||||| || |
|
|
| T |
19923972 |
gagctggagctggacttggattttgtttaggcgggccaggttgtgcaatcggctttgcctcgggcacgggctttttttctggctctttgggcttctcagg |
19923873 |
T |
|
| Q |
283 |
tgctggcttgggttttggtggttcaactatttctatgcttttgatggtaccacccccttgacaacaaatattgtctcttaccttctctg |
371 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19923872 |
tgctggcttgggttttggtggttcaactatttctatgcttttgatggtaccacccccttgacaacaaatattgtctcttaccttctctg |
19923784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 302 - 369
Target Start/End: Original strand, 56012770 - 56012837
Alignment:
| Q |
302 |
ggttcaactatttctatgcttttgatggtaccacccccttgacaacaaatattgtctcttaccttctc |
369 |
Q |
| |
|
||||| || ||||||||||||||||||| ||||| |||| |||||||| |||||||||| |||||| |
|
|
| T |
56012770 |
ggttcgacaatttctatgcttttgatggcaccacaacctttgcaacaaatcttgtctcttatcttctc |
56012837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University