View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19528_high_16 (Length: 246)
Name: NF19528_high_16
Description: NF19528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19528_high_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 24698485 - 24698587
Alignment:
| Q |
1 |
aagattgattcactcgcttgggtgaattatgctagagcagacaaggtatatattcattctatgaacaaaaaggtttcagtaaagtggaggactcaatttc |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| |
|
|
| T |
24698485 |
aagattgattcactagcttgggtgaattatgctagagcagacaaggtatatattcattctatgaacaaacaggtttcagtaaagtggaggactcaagttc |
24698584 |
T |
|
| Q |
101 |
cat |
103 |
Q |
| |
|
||| |
|
|
| T |
24698585 |
cat |
24698587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 189 - 245
Target Start/End: Original strand, 24698675 - 24698731
Alignment:
| Q |
189 |
taatgaaggaaatgcatcatctgtagcttcctagtgcccttttatgttcatctctct |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24698675 |
taatgaaggaaatgcatcatctgtagcttcctagtgcccttttatgttcatgtctct |
24698731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University