View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19528_high_19 (Length: 235)

Name: NF19528_high_19
Description: NF19528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19528_high_19
NF19528_high_19
[»] chr7 (1 HSPs)
chr7 (24-217)||(37306148-37306328)


Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 24 - 217
Target Start/End: Complemental strand, 37306328 - 37306148
Alignment:
24 tggttatttaaaaaggttatttcagcttatctctcttatagtgacattatatatatcccgtggtgaaagtctcttatctcctcataactatgttgtagga 123  Q
    |||||||||||||| |||||||||||||||||||||||  ||||||||||||    |||||||||||         ||||||||||||||||||||||||    
37306328 tggttatttaaaaaagttatttcagcttatctctcttaatgtgacattatat----cccgtggtgaa---------tctcctcataactatgttgtagga 37306242  T
124 tttgtgtagagtaacaaataaattagtttatcgtattgttagagcattatgttgcttgccttctcatagtttatagaattgtcccatattttct 217  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
37306241 tttgtctagagtaacaaataaattagtttatcgtattgttagagcattatgttgcttgccttctcatagtttatagtattgtcccatattttct 37306148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University