View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19528_high_19 (Length: 235)
Name: NF19528_high_19
Description: NF19528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19528_high_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 24 - 217
Target Start/End: Complemental strand, 37306328 - 37306148
Alignment:
| Q |
24 |
tggttatttaaaaaggttatttcagcttatctctcttatagtgacattatatatatcccgtggtgaaagtctcttatctcctcataactatgttgtagga |
123 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37306328 |
tggttatttaaaaaagttatttcagcttatctctcttaatgtgacattatat----cccgtggtgaa---------tctcctcataactatgttgtagga |
37306242 |
T |
 |
| Q |
124 |
tttgtgtagagtaacaaataaattagtttatcgtattgttagagcattatgttgcttgccttctcatagtttatagaattgtcccatattttct |
217 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37306241 |
tttgtctagagtaacaaataaattagtttatcgtattgttagagcattatgttgcttgccttctcatagtttatagtattgtcccatattttct |
37306148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University