View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19528_high_20 (Length: 232)
Name: NF19528_high_20
Description: NF19528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19528_high_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 25110946 - 25110740
Alignment:
| Q |
1 |
tcgaatctaagcacttatggaatgctttgtattgtatatgcagatattgtgtgcacaaaatggggttgtggtgggttaatcttgtagtgaccaatgtgag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25110946 |
tcgaatctaagcacttatggaatgctttgtattgtatatgcagttattgtgtgcacaaaagggggttgtggtgggttaatcttttagtgaccaatgtgag |
25110847 |
T |
|
| Q |
101 |
agaattaacctgtatgtaataaaggaatggaaattctaaataggaatcttaaaaaggtagcatttatttcttacatgtttcaccttgtattataagaaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25110846 |
agaattaacctgtatgtaataaaggaatggaaattctaaataggaatcttaaaaaggtagcatttatttcttacatgtttcaccttgtattataagaaaa |
25110747 |
T |
|
| Q |
201 |
taataag |
207 |
Q |
| |
|
||||||| |
|
|
| T |
25110746 |
taataag |
25110740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University