View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19528_high_21 (Length: 209)
Name: NF19528_high_21
Description: NF19528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19528_high_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 92 - 187
Target Start/End: Original strand, 50016705 - 50016800
Alignment:
| Q |
92 |
cataagtgagggtacaacaacaataagggagggtgtgaattggaattgggaggaatatatgccatggttgggaggtgttgtggatgaacaaatgtc |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50016705 |
cataagtgagggtacaacaacaataagggagggtgtgaattggaattgggaggaatatatgccatggttgggaggtgttgtggatgaacaaatgtc |
50016800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University