View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19528_low_12 (Length: 290)
Name: NF19528_low_12
Description: NF19528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19528_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 13 - 260
Target Start/End: Complemental strand, 7828976 - 7828729
Alignment:
| Q |
13 |
aatataacatgtaaagtcaagatgcttgaatttgtgtgccaaagctaattttgtgtgttaagaaattaaccattcaaggcatggagatctatttaagcgg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7828976 |
aatataacatgtaaagtcaagatgcttgaatttgtgtgccaaagctaattttgtgtgttaagaaattaaccattcaaggcatggagatctatttaagcgg |
7828877 |
T |
 |
| Q |
113 |
ccaacgtcttctcaccaacaatctttcatacgcattgatcatggtcaaacacatgaccacatgtttaaaagatcctatgtggttggttatttgtgcaatt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
7828876 |
ccaacgtcttctcaccaacaatctttcatacgcattgatcatggtcaaacacatgaccacatgtttaaaagatcctatgtggttggttatttgtgcattt |
7828777 |
T |
 |
| Q |
213 |
gatttcaatgatataattttagtgaataatcaaatcaatcaatagtca |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7828776 |
gatttcaatgatataattttagtgaataatcaaatcaattaatagtca |
7828729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University