View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19528_low_16 (Length: 246)

Name: NF19528_low_16
Description: NF19528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19528_low_16
NF19528_low_16
[»] chr7 (2 HSPs)
chr7 (1-103)||(24698485-24698587)
chr7 (189-245)||(24698675-24698731)


Alignment Details
Target: chr7 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 24698485 - 24698587
Alignment:
1 aagattgattcactcgcttgggtgaattatgctagagcagacaaggtatatattcattctatgaacaaaaaggtttcagtaaagtggaggactcaatttc 100  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||    
24698485 aagattgattcactagcttgggtgaattatgctagagcagacaaggtatatattcattctatgaacaaacaggtttcagtaaagtggaggactcaagttc 24698584  T
101 cat 103  Q
    |||    
24698585 cat 24698587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 189 - 245
Target Start/End: Original strand, 24698675 - 24698731
Alignment:
189 taatgaaggaaatgcatcatctgtagcttcctagtgcccttttatgttcatctctct 245  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
24698675 taatgaaggaaatgcatcatctgtagcttcctagtgcccttttatgttcatgtctct 24698731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University